Nucleotide sequence of a human 5S rRNA gene

نویسندگان
چکیده

برای دانلود باید عضویت طلایی داشته باشید

برای دانلود متن کامل این مقاله و بیش از 32 میلیون مقاله دیگر ابتدا ثبت نام کنید

اگر عضو سایت هستید لطفا وارد حساب کاربری خود شوید

منابع مشابه

Nucleotide sequence of a human 5S rRNA gene.

A gene for human 5S rRNA has been cloned and sequenced. The gene was isolated on a 638 bp fragment (Fig. 1) from human placenta DNA by digestion with BamHI and Sad and cloning into a Bluescnpt M13 plasmid. A ^P-labelled SP6-transcript of a mouse pseudogene was used as a probe. The fragment has a restriction pattern identical to the pattern of the majority of human 5S rRNA genes, which are found...

متن کامل

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum.

The nucleotide sequence of 5S rRNA from Mycoplasma capricolum is UUGGUGGUAUAGCAUAGAGGUCACACCUGUUCCCAUGCCGAACACAGAAGUUAAGCUCUAUUACGGUGAAGAUAUUACU GAUGUGAGAAAAUAGCAAGCUGCCAGUUOH. The length is 107 nucleotides long, and the shortest in all the 5S rRNAs so far known. The sequence is more similar to those of the gram-positive bacteria than those of the gram-negative bacteria.

متن کامل

The nucleotide sequence of 5S rRNA from Scenedesmus obliquus.

The nucleotide sequence of the cytoplasmic 5S ribosomal RNA from Scenedesmusobliquus has been determined using post-labelling techniques. The sequence is closely related to the 5S RNA sequence of Chlorella and contains all the areas of invariant sequence which appear to be conserved in plant cytoplasmic 5S RNA species.

متن کامل

Compilation of 5S rRNA and 5S rRNA gene sequences

This is an update for the 5S rRNA sequences of the BERLIN RNA DATABANK last published in 1990 (1). The new entry consists of 25 eubacterial and 2 eukaryotic 5S rRNA sequences and 10 plant 5S rRNA pseudogenes (Table 1). Thus the BERLIN RNA DATABANK contains as of February 1, 1991 the 5S rRNA sequences of 44 archaebacteria, 292 eubacteria, 20 plastids, 6 mitochondria, 321 eukaryotes and 21 eukary...

متن کامل

Nucleotide sequence of cytoplasmic 5S rRNA from a eukaryotic thermophilic unicellular alga, Cyanidium caldarium.

From a total RNA extract of Cyanidium caldarium (Cca) cells we isolated, by the use of polyacrylamide gel electrophoresis under denaturing conditions, cytoplasmic 5S rRNA and determined its primary and possible secondary structure (Figure 1). The Cca 5S rRNA (i) is 124 nt long, (ii) harbors, at the expected positions, both internal transcription signals characteristic of this class of RNA polym...

متن کامل

ذخیره در منابع من


  با ذخیره ی این منبع در منابع من، دسترسی به آن را برای استفاده های بعدی آسان تر کنید

ژورنال

عنوان ژورنال: Nucleic Acids Research

سال: 1990

ISSN: 0305-1048,1362-4962

DOI: 10.1093/nar/18.10.3060